mcherry genes (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
mcherry genes
Mcherry Genes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2984 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+mcherry+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pmc12796744-275-16-18
Average 96 stars, based on 2984 article reviews
Mcherry Genes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2984 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+mcherry+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pmc12796744-275-16-18
Average 96 stars, based on 2984 article reviews
mcherry genes - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Clone Assay:Article Title: Gastrula-Premarked Posterior Enhancer Primes Posterior Tissue Development Through Cross-Talk with TGF-β Signaling Pathway. Article Snippet: .. [61] Briefly, small guided RNAs (sgRNAs) were designed according to the instruction fromChopchop website (http://chopchop.cbu.uib.no/). sgRNAs were annealed and cloned into linearized Article Title: Chromatin activity of IκBα mediates the exit from naïve pluripotency Article Snippet: .. After annealing, one of the gRNAs was cloned into SpCas9(BB)–2A-GFP (px458) plasmid (Addgene; Cat #48138), and the other gRNA was cloned into the Plasmid Preparation:Article Title: Gastrula-Premarked Posterior Enhancer Primes Posterior Tissue Development Through Cross-Talk with TGF-β Signaling Pathway. Article Snippet: .. [61] Briefly, small guided RNAs (sgRNAs) were designed according to the instruction fromChopchop website (http://chopchop.cbu.uib.no/). sgRNAs were annealed and cloned into linearized Article Title: Chromatin activity of IκBα mediates the exit from naïve pluripotency Article Snippet: .. After annealing, one of the gRNAs was cloned into SpCas9(BB)–2A-GFP (px458) plasmid (Addgene; Cat #48138), and the other gRNA was cloned into the Article Title: Positional BMP signaling orchestrates villus length in the small intestine Article Snippet: .. Plasmid pX330-mCherry-Rosa26-SG was constructed by inserting the sgRNA sequence of the Rosa26 gene trap range into the Article Title: Tmem45b modulates itch via endoplasmic reticulum calcium regulation Article Snippet: .. To generate CRISPR-Cas9 plasmid for Cre Knockin (KI), sgRNAs of C-terminal of target gene Mrgprd (GGTCTGAAGGGAGCCCAACC) were synthesized, annealed, and ligated to the Article Title: Mutation-Agnostic Base Editing of the Progerin Farnesylation Site Rescues Hutchinson-Gilford Progeria Syndrome Phenotypes in Neuromuscular Organoids Article Snippet: Cells were passaged approximately every four days using Versene solution (Thermo Fisher Scientific). .. To generate FATE-iPSCs, the Article Title: Tmem45b modulates itch via endoplasmic reticulum calcium regulation. Article Snippet: .. To generate CRISPRCas9 plasmid for Cre Knockin (KI), sgRNAs of C-terminal of target gene Mrgprd (GGTCTGAAGGGAGCCCAACC) were synthesized, annealed, and ligated to the Article Title: Positional BMP signaling orchestrates villus length in the small intestine. Article Snippet: .. Plasmid pX330-mCherry-Rosa26-SG was constructed by inserting the sgRNA sequence of the Rosa26 gene trap range into the Modification:Article Title: Chromatin activity of IκBα mediates the exit from naïve pluripotency Article Snippet: .. After annealing, one of the gRNAs was cloned into SpCas9(BB)–2A-GFP (px458) plasmid (Addgene; Cat #48138), and the other gRNA was cloned into the Article Title: Mutation-Agnostic Base Editing of the Progerin Farnesylation Site Rescues Hutchinson-Gilford Progeria Syndrome Phenotypes in Neuromuscular Organoids Article Snippet: Cells were passaged approximately every four days using Versene solution (Thermo Fisher Scientific). .. To generate FATE-iPSCs, the Construct:Article Title: Positional BMP signaling orchestrates villus length in the small intestine Article Snippet: .. Plasmid pX330-mCherry-Rosa26-SG was constructed by inserting the sgRNA sequence of the Rosa26 gene trap range into the Article Title: Positional BMP signaling orchestrates villus length in the small intestine. Article Snippet: .. Plasmid pX330-mCherry-Rosa26-SG was constructed by inserting the sgRNA sequence of the Rosa26 gene trap range into the Sequencing:Article Title: Positional BMP signaling orchestrates villus length in the small intestine Article Snippet: .. Plasmid pX330-mCherry-Rosa26-SG was constructed by inserting the sgRNA sequence of the Rosa26 gene trap range into the Article Title: Mutation-Agnostic Base Editing of the Progerin Farnesylation Site Rescues Hutchinson-Gilford Progeria Syndrome Phenotypes in Neuromuscular Organoids Article Snippet: Cells were passaged approximately every four days using Versene solution (Thermo Fisher Scientific). .. To generate FATE-iPSCs, the Article Title: Positional BMP signaling orchestrates villus length in the small intestine. Article Snippet: .. Plasmid pX330-mCherry-Rosa26-SG was constructed by inserting the sgRNA sequence of the Rosa26 gene trap range into the other:Article Title: SPNS1 variants cause multiorgan disease and implicate lysophospholipid transport as critical for mTOR-regulated lipid homeostasis Article Snippet: Cells were lysed in RIPA (Thermo Fisher) supplemented with cOmplete protease inhibitor. CRISPR:Article Title: Tmem45b modulates itch via endoplasmic reticulum calcium regulation Article Snippet: .. To generate CRISPR-Cas9 plasmid for Cre Knockin (KI), sgRNAs of C-terminal of target gene Mrgprd (GGTCTGAAGGGAGCCCAACC) were synthesized, annealed, and ligated to the Knock-In:Article Title: Tmem45b modulates itch via endoplasmic reticulum calcium regulation Article Snippet: .. To generate CRISPR-Cas9 plasmid for Cre Knockin (KI), sgRNAs of C-terminal of target gene Mrgprd (GGTCTGAAGGGAGCCCAACC) were synthesized, annealed, and ligated to the Article Title: Tmem45b modulates itch via endoplasmic reticulum calcium regulation. Article Snippet: .. To generate CRISPRCas9 plasmid for Cre Knockin (KI), sgRNAs of C-terminal of target gene Mrgprd (GGTCTGAAGGGAGCCCAACC) were synthesized, annealed, and ligated to the Synthesized:Article Title: Tmem45b modulates itch via endoplasmic reticulum calcium regulation Article Snippet: .. To generate CRISPR-Cas9 plasmid for Cre Knockin (KI), sgRNAs of C-terminal of target gene Mrgprd (GGTCTGAAGGGAGCCCAACC) were synthesized, annealed, and ligated to the Article Title: Tmem45b modulates itch via endoplasmic reticulum calcium regulation. Article Snippet: .. To generate CRISPRCas9 plasmid for Cre Knockin (KI), sgRNAs of C-terminal of target gene Mrgprd (GGTCTGAAGGGAGCCCAACC) were synthesized, annealed, and ligated to the Variant Assay:Article Title: Mutation-Agnostic Base Editing of the Progerin Farnesylation Site Rescues Hutchinson-Gilford Progeria Syndrome Phenotypes in Neuromuscular Organoids Article Snippet: Cells were passaged approximately every four days using Versene solution (Thermo Fisher Scientific). .. To generate FATE-iPSCs, the |